Contents 1 Pinyin 2 English reference 3 Overview 4 Latin name 5 English name 6 Alias ??of black snake 7 Prescription name of black snake 8 Source 9 Original animal form 10 Origin 11 Harvesting and primary processing 12 Properties of crude drugs 13 Physical and chemical identification 14 Processing of black snake 14.1 Processing method of black snake 14.1.1 Black snake 14.1.2 Black snake meat 14.1.3 Liquor black snake 14.2 Properties of finished product 14.3 Processing effect 14.4 Processing research 14.5 Storage method 15 Meridian distribution of nature and flavor 16 Functions and indications 17 Chemical components 18 Pharmacological effects of black snake Strong, straight body) 19.5 Treat woody tongue swelling and congestion 20 Pharmacopoeia standard of black snake Meat 20.6.1.3 Liquor black snake 20.6.2 Identification 20.6.2.1 Template DNA extraction 20.6.2.2 PCR reaction 20.6.2.3 Electrophoresis detection 20.6.3 Nature, flavor and menstruation 20.6.4 Function and indication 20.6.5 Usage and dosage 20.6. 6 Storage 20.7 Source 21 References attached: 1 Prescriptions using the Chinese medicine Wushao Shen 2 Chinese patent medicines using the Chinese medicine Wushao Snake 3 Wushao Snake in ancient books 1 Pinyin
wū shāo shé 2 English reference
black snake [Xiangya Medical Professional Dictionary]
zaocys [Xiangya Medical Professional Dictionary]
Zaocys (拉) [TCM Terminology Approval Committee. Traditional Chinese Medicine Pharmaceutical Terms (2004)]
blacktail snake [Traditional Chinese Medicine Terms Approval Committee. Traditional Chinese Medicine Terms (2004)]
3 Overview
Blacktail snake is a traditional Chinese medicine The name comes from "Compendium of Materia Medica" [1]. It is the dried body of the colubrid snake Zaocys dhumnades (Cantor) [2]. The black-tip snake is disc-shaped, with a disc diameter of about 16cm. The surface is dark brown or green-black, densely covered with diamond-shaped scales; the scales on the back are in pairs, and the 2 to 4 rows of scales in the center of the back are strongly ridged, forming two black lines running through the entire body. The head is in the middle, oblate, and the eyes are large and sunken, shiny. There are 8 scales on the upper lip, the 4th and 5th are in the orbit, 1 scale on the cheek, 1 scale under the eyes, which is smaller, and 2 scales behind the eyes. The ridge rises like a roof. The cut edge of the abdomen is curled inward, the spinal muscles are thick, yellowish white or light brown, and the neatly arranged ribs can be seen. The tail is tapered and long, with double rows of scales under the tail. The peeler leaves only the skin scales on the head and tail, and the middle part is smoother. The smell is fishy and the taste is light. The pieces of Wushao Snake are segment-shaped, with black or dark brown skin, dull, yellowish white or grayish brown cut surface, hard texture, fishy odor and light taste [3].
The meat of Wushao snake is in the shape of segments, without skin and bones, the meat is thick and soft, yellow-white or gray-black, tough in texture, with a fishy smell and a slight alcohol smell [3]. The color of Liquor Snake is darker and has a slight smell of alcohol [3].
Black-leaf snake is sweet in taste and neutral in nature. It returns to the liver meridian and has the effects of dispelling wind, unblocking collaterals and relieving spasm. It is used for rheumatism, numbness and spasm, stroke, mouth and eyes, hemiplegia, convulsions and spasms, tetanus, leprosy, and scabies. Wushao Snake pieces have the function of dispelling wind and relieving itching [3]. Liquor black snake enhances the effect of dispelling wind, dredging meridians and relieving spasm, and is mostly used for rheumatic paralysis, numbness of limbs, tight muscles and veins, stroke, crooked mouth and eyes, hemiplegia, convulsions, convulsions, skin tinea, and leprosy [3]. 4 Latin name
Zaocys (La) ("Traditional Chinese Medicine Terminology (2004)") 5 English name
blacktail snake ("Traditional Chinese Medicine Terminology (2004)") 6 Blacktail snake Alias ??of
Black Snake ("Medicinal Property Theory")
Black Wind Snake[1].
Black Snake ("Kaibao Materia Medica")
Sword Wushao ("Compendium of Materia Medica")
Black Flower Snake ("Compendium of Materia Medica")
Black-peaked snake (Chen Yi's "Zoology")
Black-flowered snake, sword-backed snake, sword-backed blackhead snake 7 Prescription names for blackhead snake
Black snake, black snake, black snake meat, prepared black snake[3]. 8 Source
"Pharmacopoeia of the People's Republic of China and the People's Republic of China" (2010 edition): Zaocys dhumnades (Cantor) is the dried body of the colubrid snake Zaocys dhumnades (Cantor). They are mostly caught in summer and autumn. The abdomen is cut open or the skin is left first to leave the head and tail. The internal organs are removed, rolled into a disc shape, and dried.
"Dictionary of Traditional Chinese Medicine": The black snake is the dried whole body of the colubrid family Zaocys dhumnades (Cantor) with its internal organs removed [1]. 9 Original animal form
The total length of the black snake can reach more than 2 meters. The head is oblate; the boundary between the head and neck is not obvious. The rostrum can be seen from the back. The internasal scale is wider than long, and the suture line with the rostrum scale is much shorter than the suture line with the nasal scale. The forehead scales are large, and the suture line between the two scales is equal to the distance from its front edge to the snout, wider than long, and the outer edge wraps to the head side. The frontal scales are larger in front and smaller in back, and their length is equal to the sum of the internasal scales and forehead scales. The upper eye scales are wide and the length is equal to the distance from the front edge of the frontal scales to the tip of the snout. The nostrils are oval and located between the two nasal scales. There is one buccal scale, which is connected to the 2nd and 3rd upper labial scales. There are 2 scales in front of the eyes, and the upper edge wraps to the back of the head. The eyes are large and there are 2 scales behind the eyes. There are two temporal scales in the front and back rows, and the front row is narrow and long. There are 8 scales on the upper lip, with the 4th and 5th scales entering the eye; the 6th scale is the largest. The anterior mental scale is shorter than the posterior mental scale and is connected to the first five lower labial scales. There is a pair of small scales between the posterior cheek scales and the first abdominal scale. There are 11 scales on the lower lip, the 6th being the largest. There are 16 to 14 rows of body scales, and 2 to 6 rows of ribs in the center of the back. There are 186 to 205 abdominal scales, 2 anal scales, and 101 to 128 pairs of lower tail scales. The tail tapers. The body is green-gray brown, and the edges of each scale are dark brown. The two rows of scales in the center of the back are yellow or tan, and the two outer rows of scales are black vertical lines. The upper lip and throat are light yellow. The ventral surface is grayish white. Its rear part is bluish gray. ("Dictionary of Traditional Chinese Medicine") 10 Place of Origin
"Dictionary of Traditional Chinese Medicine": Black Snake is mainly produced in Zhejiang, Jiangsu, Guizhou, Hubei and other places [1]. 11 Harvesting and primary processing
"Chinese Pharmacopoeia" (2010 edition): If caught in summer and autumn, cut open the abdomen or peel off the head and tail first, remove the internal organs, and plate them. Shape into discs and dry. 12 Properties of Crude Drugs
"Pharmacopoeia of the People's Republic of China and the People's Republic of China" (2010 edition): The snakehead snake is disc-shaped, with a disc diameter of about 16cm. The surface is dark brown or green-black, densely covered with diamond-shaped scales; the scales on the back are in pairs, and the 2 to 4 rows of scales in the center of the back are strongly ridged, forming two black lines running through the entire body. The head is in the middle, oblate, and the eyes are large and sunken, shiny.
There are 8 scales on the upper lip, the 4th and 5th are in the orbit, 1 scale on the cheek, 1 scale under the eyes, which is smaller, and 2 scales behind the eyes. The ridge rises like a roof. The cut edge of the abdomen is curled inward, the spinal muscles are thick, yellowish white or light brown, and the neatly arranged ribs can be seen. The tail is tapered and long, with double rows of scales under the tail. The peeler leaves only the skin scales on the head and tail, and the middle part is smoother. The smell is fishy and the taste is light. 13 Physical and chemical identification
The powder of black tip snake is fluorescent or light brown. The horny scales are nearly colorless or light yellow, with longitudinal stripes on the surface. The surface of the epidermis is densely covered with brown or brown-black pigment particles, which are often connected into a network, branched or aggregated into groups. Striated muscle fibers are light yellow or nearly colorless. There are fine horizontal stripes of alternating light and dark colors. The bone fragments are nearly colorless or light gray and appear as irregular fragments. The bone lacunae are long and spindle-shaped, mostly arranged in the same direction, and the bone canaliculi are dense and thick. 14 Preparation of Black Snake
In the Tang Dynasty, there was a method of grilling the head and tail and taking out the meat ("Waitai Mi Yao") [3].
In the Song Dynasty, wine roasting, vinegar making, baking ("Taiping Shenghui Prescription"), wine baking ("Pediatric Medicine Zhijue"), wine simmering, crisping and concoction were added. Methods include making ("Zonglu of Shengji"), cooking with wine ("Bian Quexinshu"), and burning ("Replacing Materia Medica for Chongxiuzhenghejingzhengzheng") [3].
In the Qing Dynasty, the methods of wine steaming ("Ben Cao Shu") and steaming ("Holing Materia Medica") were added [3].
The main processing methods now include wine soaking, wine roasting, etc. [3]. 14.1 Preparation method of Black Snake 14.1.1 Black Snake
Take the original medicinal materials, remove the head, scales and ash, cut into sections, and sieve out the debris [3]. 14.1.2 Black-tip snake meat
Take the black-tip snake, remove the head, scales and ash, suffocate it with a certain amount of rice wine, take it out while it is wet, remove the skin and bones, cut into sections, dry and sieve away the debris. [3].
For every 100kg of black snake, use 20kg of rice wine[3]. 14.1.3 Wine-coated snake
Take the clean snake segments, add a certain amount of rice wine, mix well, and make it slightly moist. After the wine is absorbed, place it in a frying container, heat it over a slow fire, and stir-fry until It is slightly yellow, take it out and let it cool, then sieve to remove the debris [3].
For every 100kg of black snake segments, use 20kg of rice wine[3]. 14.2 Characteristics of the finished product
The black snake is segment-shaped, with a black or dark brown skin, matte, and a yellowish-white or grayish-brown cross section [3]. Hard quality[3]. The smell is fishy and the taste is light [3].
The meat of black snake is in the shape of segments, without skin and bones, the meat is thick and soft, yellowish white or grayish black[3]. Tough quality[3]. The smell is fishy and slightly alcoholic[3].
The color of Liquor Snake is darker and slightly smells of alcohol[3]. 14.3 Processing effect
The blackhead snake has the function of dispelling wind and relieving itching [3]. For example, Wu She Ointment ("Taiping Shenghui Prescription") is used to treat wind and pruritus; anti-allergic tablets are used to treat eczema and itching ("Journal of Traditional Chinese Medicine" Issue 3, 1980) [3].
Roasting with wine can enhance the effect of dispelling wind, dredging collaterals and relieving spasm, and can correct odor and preserve food, making it easier to take and store [3]. It is mostly used for rheumatic arthralgia, numbness of limbs, tight muscles and veins, stroke, crooked mouth and eyes, hemiplegia, convulsions, convulsions, skin tinea, and leprosy [3]. For example, Wu She Wan is used to treat rheumatism and paralysis, and the hands and feet are weak and unable to stretch ("Taiping Shenghui Prescription"); Dingming Powder is used to treat tetanus, the neck is tight and stiff, and the body is stiff ("Shengji Zonglu"); it is used to treat leprosy. Wu She Wan ("Secret Leprosy Pills"); Sanwei Wu She Powder ("Sheng Ji Zong Lu") to treat all dry and wet ringworms [3]. 14.4 Processing research
The whole snakehead contains 17 kinds of amino acid components including lysine, leucine, and aspartic acid [3]. Snake sloughs contain bone kerogen, and muscles contain fructose 1,6-bisphosphatase and tropomyosin (TM) [3]. Snake gall contains bile acid and insulin [3].
The aqueous decoction or alcohol extract of Black Snake Snake has significant anti-inflammatory, analgesic and anti-convulsant effects. The alcohol extract can still resist the occurrence of pentylenetetrazole convulsions in mice, and its anti-convulsant effect is strong Equivalent to 25 mg/kg of phenobarbital sodium [3].
The preparation of Wushao Snake wine can make the water-insoluble lipid components easy to decoct and improve its anticonvulsant effect [3]. At the same time, it can prevent the snake from mildew, deterioration, and insect infestation [3].
The head and skin of the black snake are the main basis for species identification and should be retained during processing in the place of origin for identification [3]. Others believe that the snake is a non-venomous snake with no venom glands on its head. In order to save medicinal materials, the head may not be removed when preparing it [3].
For research on the processing technology of wine-roasted black snake, there are reports that take clean black snake segments, mix them with rice wine, put them in a container, cover them, and put them in the oven to suffocate at 30C for 30 minutes. Take them out and let them cool thoroughly. , then open it and put it into the oven for low temperature drying at 60°C for 15 minutes, take it out and let it cool in a ventilated and dry place [3]. There are also empirical methods of frying bran in wine and roasting it in wine, and steaming, cutting into sections, frying in sand, spraying with wine, and drying [3]. 14.5 Storage method
Store in a lime jar, or store with Zanthoxylum bungeanum, or spray a little alcohol, seal, and store in a ventilated and dry place [3]. Moisture-proof and moth-proof[3]. 15 Meridian tropism of nature and flavor
"Pharmacopoeia of the People's Republic of China" (2010 edition): Wushao Snake has a sweet taste and a neutral nature. Returns to liver meridian.
"Dictionary of Traditional Chinese Medicine": Black Snake is sweet in taste and neutral in nature [1]. Enters the liver and lung meridians [1]. 16 Functions and Indications
"Pharmacopoeia of the People's Republic of China and the People's Republic of China" (2010 edition): The snake has the effects of dispelling wind, unblocking collaterals, and relieving spasm. It is used for rheumatism, numbness and spasm, stroke, mouth and eyes, hemiplegia, convulsions and spasms, tetanus, leprosy, and scabies.
"Dictionary of Traditional Chinese Medicine": Black-tip snake has the effect of dispelling rheumatism, dredging meridians and attacking poison [1]. It can be used to treat rheumatic arthralgia, stroke and hemiplegia, skin numbness, bone and joint tuberculosis, poliomyelitis, tetanus, leprosy, rash and itching, and scabies [1].
"Traditional Chinese Medicine Processing Science":
The black-headed snake has the function of dispelling wind and relieving itching [3]. For example, Wu She Ointment ("Taiping Shenghui Prescription") is used to treat wind and pruritus; anti-allergic tablets are used to treat eczema and itching ("Journal of Traditional Chinese Medicine" Issue 3, 1980) [3].
Jiu Wushao Snake enhances the effect of dispelling wind, dredging meridians and relieving spasm. It is mostly used for rheumatic paralysis, numbness of limbs, tight muscles and veins, stroke, crooked mouth and eyes, hemiplegia, convulsions, convulsions, and stubborn skin. Ringworm, leprosy[3]. For example, Wu She Wan is used to treat rheumatism and paralysis, and the hands and feet are weak and unable to stretch ("Taiping Shenghui Prescription"); Dingming Powder is used to treat tetanus, the neck is tight and stiff, and the body is stiff ("Shengji Zonglu"); it is used to treat leprosy. Wu She Wan ("Secret Leprosy Pills"); Sanwei Wu She Powder ("Sheng Ji Zong Lu") to treat all dry and wet ringworms [3]. 17 Chemical composition
The whole black snake contains protein and fat [1].
The whole black snake contains 17 kinds of amino acid components such as lysine, leucine, and aspartic acid [3]. Snake sloughs contain bone kerogen, and muscles contain fructose 1,6-bisphosphatase and tropomyosin (TM) [3]. Snake gall contains bile acid and insulin [3]. 18 Pharmacological effects of the blackhead snake
The blackhead snake has anti-inflammatory, analgesic, anticonvulsant, and anti-venom effects [1].
The aqueous decoction or alcohol extract of Black Snake Snake has significant anti-inflammatory, analgesic and anti-convulsant effects. The alcohol extract can still resist the occurrence of pentylenetetrazole convulsions in mice, and its anti-convulsant effect is strong Equivalent to 25 mg/kg of phenobarbital sodium [3].
The preparation of Wushao Snake wine can make the water-insoluble lipid components easy to decoct and improve its anticonvulsant effect [3].
"Pharmacopoeia of the People's Republic of China and the People's Republic of China" (2010 edition): 6 ~ 12g.
"Dictionary of Traditional Chinese Medicine": Oral administration: decoction, 4.5-12g; grind into powder and swallow, 0.9-1.5g each time [1]. It can also be soaked in wine and taken [1]. 19 Selected Black Snake Prescriptions 19.1 Treating Leprosy
Steam three strips of Black Snake. Bake the meat, grind it into powder, add steamed cakes to make balls, as big as rice grains. Feed the black-bone chicken with this, and when the food is gone, kill the chicken and cook it. Bake the chicken and grind it into powder. For every penny spent, wine will be given away. Or you can add steamed cakes and take it as a pill.
After eating three or five black-bone chickens, my mother will recover. Another recipe: catch a big black snake, beat it to death, wait until it is rotten, add two bowls of water and soak it for seven days, remove the slope and bones, add one liter of brown rice and soak it for one day. Dry the rice and feed it to a white chicken (make the chicken hungry for one day). When the feathers fall off, kill the chicken and cook it. Drink a moderate amount of alcohol while eating. After eating the chicken, use a basin of hot water and bath for a long time, and the disease will heal on its own. ("Dictionary of Traditional Chinese Medicine") 19.2 To treat purple vitiligo
Use 6 liang of black snake meat (roasted in wine), 2 liang of Citrus aurantium (stir-fried with bran), Achyranthes bidentata, Gastrodia elata, 4 liang of Rehmannia glutinosa, and white Two ounces each of Tribulus terrestris (fried), Acanthopanax bark, Fangfeng, and Guixin. Cut each into thin slices, put them in a bag, soak them in two buckets of wine, and seal them for seven days. Take a small amount of it warmly at a time. Avoid eating chickens, geese, and rays. ("Dictionary of Traditional Chinese Medicine") 19.3 Treat the baby's pinched mouth and inability to suck milk
Use half a liang of black snake (soaked in wine, peeled, boned, and dried), one point of musk, and grind it For the end. Take half a minute of each time and drink it with Nepeta decoction. ("Dictionary of Traditional Chinese Medicine") 19.4 Treat tetracycline and stroke (strong head, straight body)
Use white snake and black snake, take two inches of the rear end of each, wash with wine, scrape out the flesh, and add the whole A centipede is burnt to the end. Take it every time and mix it with warm wine. This prescription is called "Dingming San". ("Dictionary of Traditional Chinese Medicine") 19.5 Treat woody tongue swelling and congestion
Use a piece of snake gallbladder, bake it, grind it into powder, and apply it on the tongue. If there is saliva, the leaves will go away. ("Dictionary of Traditional Chinese Medicine") 20 Pharmacopoeia standard of Wushaoshe 20.1 Product name
Wushaoshe
Wushaoshe
ZAOCYS 20.2 Source
This product is the dried body of the colubrid snake Zaocys dhumnades (Cantor). They are mostly caught in summer and autumn. The abdomen is cut open or the skin is left first to leave the head and tail. The internal organs are removed, rolled into a disc shape, and dried. 20.3 Properties
This product is disc-shaped with a diameter of about 16cm. The surface is dark brown or green-black, densely covered with diamond-shaped scales; the scales on the back are in pairs, and the 2 to 4 rows of scales in the center of the back are strongly ridged, forming two black lines running through the entire body. The head is in the middle, oblate, and the eyes are large and sunken, shiny. There are 8 scales on the upper lip, the 4th and 5th are in the orbit, 1 scale on the cheek, 1 scale under the eyes, which is smaller, and 2 scales behind the eyes. The ridge rises like a roof. The cut edge of the abdomen is curled inward, the spinal muscles are thick, yellowish white or light brown, and the neatly arranged ribs can be seen. The tail is tapered and long, with double rows of scales under the tail. The peeler leaves only the skin scales on the head and tail, and the middle part is smoother. The smell is fishy and the taste is light. 20.4 Identification
The powder of this product is fluorescent or light brown. The horny scales are nearly colorless or light yellow, with longitudinal stripes on the surface. The surface of the epidermis is densely covered with brown or brown-black pigment particles, which are often connected into a network, branched or aggregated into groups. Striated muscle fibers are light yellow or nearly colorless. There are fine horizontal stripes of alternating light and dark colors. The bone fragments are nearly colorless or light gray and appear as irregular fragments. The bone lacunae are long and spindle-shaped, mostly arranged in the same direction, and the bone canaliculi are dense and thick. 20.5 Leaching substance
Determine according to the hot soak method under the alcohol-soluble leachable determination method (Appendix X A), use dilute ethanol as the solvent, and shall not be less than 12.0. 20.6 Black Snake slices 20.6.1 Preparation 20.6.1.1 Black Snake
Remove the head and scales, and cut into inch-long sections. 20.6.1.2 Black snake meat
After removing the head and scales, simmer it with rice wine, remove the skin and bones, and dry. 20.6.1.3 Liquor black snake
Take the clean black snake segments and fry them dry according to the wine roasting method (Appendix IID).
For every 100kg of black snake, use 20kg of rice wine.
This product is in segment form. Tan or black, slightly alcoholic. 20.6.2 Identification
Polymerase chain reaction method.
20.6.2.1 Extraction of template DNA
Take 0.5g of this product, place it in a mortar, add an appropriate amount of liquid nitrogen, grind it thoroughly to make it into powder, take 0.g and place it in a 1.5ml centrifuge tube, and add 275μl of digestion solution [200 μl of cell nuclear lysis solution, 50 μl of 0.5 mol/L disodium ethylenediaminetetraacetate solution, 20 μl of proteinase K (20 mg/m1), 5 μl of RNase solution], incubate in a water bath at 55°C for 1 hour, add 250 μl of lysis buffer, and mix Evenly, add to the DNA purification column, centrifuge (speed: 10,000 rpm) for 3 minutes; discard the filtrate, add 800 μl of eluent [26 μl of 5 mol/L potassium acetate solution, 1 mol/L Tris hydrochloric acid solution (pH value 7.5 ) 18 μl, 3 μl of 0.5 mol/L disodium ethylenediaminetetraacetate solution (pH 8.0), 480 μl of absolute ethanol, 273 μl of sterile double-distilled water], centrifuge (speed: 10,000 rpm) for 1 minute; discard and filter solution, repeatedly elute 3 times with the above eluent, centrifuge (speed: 10,000 rpm) for 1 minute each time; discard the filtrate, centrifuge for another 2 minutes, transfer the DNA purification column to another centrifuge tube, and add Add 100 μl of sterile double-distilled water, place at room temperature for 2 minutes, centrifuge (speed: 10,000 rpm) for 2 minutes, take the supernatant as the test solution, and store at minus 20°C for later use. Take another 0.5g of the black shoot snake control medicinal material and prepare the reference medicinal material template DNA solution in the same way. 20.6.2.2 PCR reaction
Identification primers: 5'GCGAAAGCTCGACCTAGCAAGGGGACCACA3' and 5'CAGGCTCCTCTAGGTTGTTATGGGGTACCG3'. PCR reaction system: performed in a 200μl centrifuge tube, the total reaction volume is 25μl, the reaction system includes 2.5μl of 10×PCR buffer, 2μl of dNTP (2.5mmol/L), 0.5 positive of each identification primer (10μmol/L), high fidelity TaqDNA polymerase (5U/μl) 0.2μl, template 0.5μl, sterile double-distilled water 18.8μl. Place the centrifuge tube in a PCR machine. PCR reaction parameters: pre-denaturation at 95°C for 5 minutes, cycle reaction 30 times (95°C for 30 seconds, 63°C for 45 seconds), and extension (72°C) for 5 minutes. 20.6.2.3 Electrophoresis detection
According to the agarose gel electrophoresis method (three appendices VIB), the gel concentration is 1, and the nucleic acid gel stain GelRed is added to the gel; the PCR reaction solution of the test sample and the control medicinal material The loading volume of each was 8 μl, and the loading volume of DNA molecular weight marker was 2 μl (0.5 μg/μl). After electrophoresis, take the gel piece and inspect it on a gel imager or UV transilluminator. In the gel electrophoresis pattern of the test product, there should be a single DNA band at 300 to 400 bp at the position corresponding to the gel electrophoresis pattern of the control medicinal material. 20.6.3 Nature, flavor and meridians
Sweet, flat. Returns to liver meridian. 20.6.4 Functions and indications
Expelling wind, unblocking collaterals, and relieving spasm. It is used for rheumatism, numbness and spasm, stroke, mouth and eyes, hemiplegia, convulsions and spasms, tetanus, leprosy, and scabies. 20.6.5 Usage and dosage
6~12g. 20.6.6 Storage
Store in a dry place to prevent mildew and moth. 20.7 Source
"The Pharmacopoeia of the People's Republic of China" 2010 Edition 21