QPCR Primer Design+Online Verification
Methods 1: NCBI probe
1. Before NCBI, there is a probe option to design primers directly, which will give the upstream and downstream sequences. For example, the mouse nanog gene was searched and the following two primers were obtained:
Upstream primer: TTGCTTACAAGGGTCTGCTACT
Downstream primer: ACTGGTAGAAGAATCAGGGCT
Method 2: Primer3web
Reference: Primer3web online primer design-learn minimalist primer design in 2 minutes! -Bi Li Bi Li
2. 1. Searching for gene sequence
Taking human p53 as an example, a primer was designed.
PubMed official website:
Step 1: Select nucleotides from the drop-down options.
Step 2: Input gene+species +mRNA (such as p53humanmRNA).
Step 3: Click Search.
Step 4: Click and select (mRNA4.782) in the left column.
Step 5: Click to enter the first article of p53humanmRNA we are looking for (Homosapiens _ mRNA _ for _ p53, complete CDs).
Step 6: Click the CDS option in the selection function.
Step 7: Click to select the FASTA format, and the CDS series of this gene will appear.
2.2. Start designing primers.
Primer3web official website:
/
After entering Primer3web official website, do the following:
Step 1: Select the species (human) from the drop-down item.
Step 2: Enter the CDS sequence you just copied in the input box.
Step 3: Click to select primers.
Step 4, outputting a primer sequence; Finally, there are four pairs of primers to choose from.
Choosing the Right Primer: How?
First of all, the amplification length of primers should be considered, and it is best to amplify between 100~300bp.
The length of primers is 20~25bp, and the difference between upstream and downstream primers should not exceed 5bp.
Then look at the Tm value, about 60℃, and the difference should not exceed 1℃.
Add one more thing:
Since the qPCR primer is designed, it must be designed across exons to avoid the influence of genomic DNA on CT value. If it does not cross the exon, the CT value of the amplification dissolution curve will be smaller. So how do you know if the primer you designed is designed across exons?
The answer is that we can compare the genomic position of our designed primer with the connecting position of exon and intron of this gene on NCBI. Just look at the connection position of mRNA of that gene directly.
Method 3:NCBI- explosion-primer-explosion
After the above primer design is completed, it is too troublesome to manually find out whether the primer crosses the intron. Then popularize more convenient methods.
Reference:
3. 1: Find the mRNA sequence of the target gene on NCBI.
Open the main page of NCBI, select the gene, enter the gene name-"Show many different genes with the same name-"Find the species you want, open-"Show the gene information, find the nm * * * * * * * front of" mRNAandprotein ",and copy the number.
Note: At this time, you will see a lot of information about NM**** * *, indicating that the different isoforms of this gene can be determined by consulting the literature and the explanations behind these gene sequences. If it is not clear, generally choose the longest.
3.2. Start designing primers that span exons.
Open the -BLAST-primer-blast website on NCBI, enter the mRNA number copied above into the sequence box, select your species from the drop-down options, then select Primerusspananexon-exonjunction from the Exonjunctionspan drop-down box, set the minimum and maximum primer length, and then click Getprimer. You can jump to the Primer-blast results page. This process will be a little long, wait a little. When it comes out, there is a column called Graphicalviewofprimerpairs, which will tell which exons the designed primers have passed through.
Select the best pair from these primer pairs spanning exons:
A) Only one primer in a pair passes through the exon. (Because a primer passes through the intron, it will not match the genomic DNA. Even if another primer matches genomic DNA, one primer will not amplify anything. Because the amplification of a primer can not reach exponential growth, after dozens of cycles, the signal is masked by the correctly matched exponential growth signal. Just like ordinary PCR, there are only upstream or downstream primers, and there is absolutely no primer in PCR. Because the output is too low. )
B) The distance between a pair of primers should not be too long, because the amplified product should be between 100-300bp, which will affect the ct value.
Verify what the designed primer PCR produces? You can do an electronic PCR to see.
1.UCSC- chip PCR tool
Enter the UCSC, select the tool In-SilicoPCR, enter the upstream and downstream primers, select the genomeassembly at the target, and click Submit, or if you can't get out in this way, remember to check the FlipReversePrimer. Because upstream and downstream may be reversed. If the submission is successful, a long sequence will come out, which will tell you the location and start-stop length of the sequence generated after the completion of this electronic PCR. Then use the gene option of NCBI to input the target gene of your own PCR, and look at the starting position of the target gene to know whether PCR is the target gene sequence.
Note: the sequence generated by OCR can only be a part of the target gene, just compare the starting position of the sequence. Because the primers were designed with the target gene, the sequence between the two primers was obtained by PCR.
Enter NCBI-blast-primer blast; Or go directly to this website: Primerdesigningtool ()
Enter the upstream and downstream primers you just designed in the primerparameter.
Select RefseqmRNA in the database drop-down option.
Click Getprimer again.
Wait a minute, it will be stuck for a while before you come out.
A detailed preliminary report came out; It is said that the Productsontargettemplate are all different transcripts of HomosapientumorproteinP 53 (TP53), and the length of the products is the same. It showed that the gene was amplified by these primers.
Advantages and disadvantages of two verification methods:
UCSC verification method can test all the sequences you amplify;
BLAST of NCBI can only give whether the amplified product is the gene you want and the length of the amplified product.
Selection: It is suggested to design primers by NCBI-blast- Primer -BLAST method, or you can verify your designed primers by NCBI-BLAST- Primer -BLAST method.
Technology sharing qPCR primer design has a coup -Zhihu ()
For example, the qPCR primer designed by the gene Syt4 (mouse).
Step 1: Input the NCBI gene and find the NM * * * * number of the gene mRNA.
Step 2: Enter the number into the NCBI- Explosion-Initiator-Explosion input sequence box, and check the corresponding conditions; The length of PCR products is limited to 70-300; Therefore, 10 cross intron primers were designed, and the second pair of primers was selected according to Tm conditions:
Upstream: GTGTCTGGACTTTCAGATCCCT
Downstream: CCAACCGTCCAATCACCTCA
Step 3: Re-enter the pair of primers into the upstream and downstream primer boxes of NCBI-BLAST-primer-blast, and click Getprimers. It was found that the only gene amplified by this pair of primers was Syt4 gene, which indicated that this pair of primers had good specificity.
Step 4: Enter UCSC-Tools-in-silica PCR, enter the upstream and downstream primers, and click Submit. If there is no product after jumping out, go back and adjust the parameters, such as target parameter, FlipReversePrimer: check or not, etc. The final product is Syt4 with a length of 220bp. It shows that the PCR products of these primers have high specificity and only one product.
Step 5: Further verification: Because the primer was designed to pass through the intron, and reminded me that the upstream primer passed through the intron, so I entered the NCBI- nucleotide, entered: Syt4MusmusculusmRNA, clicked Search, then clicked the mRNA in the left column, and then clicked the first item ...... Refer to Step 2 above.1. Looking for the CDS sequence of this gene, after finding the CDS sequence, we searched the upstream and downstream primers and found that they are both in the CDS region, and the PCR product sequences of these primers are also in the CDS region. After careful examination, we found that the upstream primer is located at 1203- 1224, which really spans two exons: exon1098 ...126544.
Above, we designed the qPCR primer sequence of Syt4 gene. Can be directly synthesized by the company.
All of the above are primer designs of qPCR. Generally, the amplified gene product is only between 100-300bp, which is used for quantitative or semi-quantitative. But if you want to amplify full-length DNA, you need Primer5 software. The length of the amplification product can be set by itself.
How to use PrimerPremier5 software to design PCR primers-Baidu Experience ()
How to design Primer3 online? The first thing depends on what the primer you designed is for. If it is used for common PCR detection or RealtimePCR, copy the mRNA sequence and select the corresponding size. In principle, the product size of common PCR is controlled between 250~600bpRealtimePCR and 100 ~ 200. It is best to blast the primer pairs given by the system and choose the primer pairs across exons.
You don't need to pay too much attention to the classical rules of primer design, such as the number of GC% at the end. Primer3' s own design algorithm is very good, and the primers designed in time have dimer hairpin structure, which will not affect the use or even be very easy to use in most cases.
If it is an extended fixed sequence, you don't need to look at GC% with Primer3 basically, and there is no continuous repeating sequence on average. This part is another point.
How to design primers with Primer6.0? 1. First, select the target gene sequence. There is no requirement for the format, just copy the target gene sequence.
2. Open "New" in the file directory and select "Sequence". Another project option here is the way of importing a file, that is, saving the target gene as a file can be directly imported into the file. Copying is generally more convenient.
3. After opening the sequence, a paste box will pop up. Just paste the gene sequence you just copied, and then click Add below.
4. Select the buttons with red and blue arrows to design primers. Before the design begins, you can change the design parameters, including base range searched, primer length, base number, number of primers displayed in the design results, etc.
5. After setting the parameters, click Search below, and the software begins to analyze and design. When you are finished, click OK. The design results will be shown as follows.
6. In the results, blue is the pre-primer, red is the post-primer, and Rating is the comprehensive evaluation score of primers. The top will also show the advantages and disadvantages of primers, the best is the best, the middle is good, and the worst is bad. Generally, the primer is the best or good, and other monitors are not available.
7. There are two options on the right. AllPrimers can view multiple pairs of different primers to choose from. Primers with appropriate positions and product lengths can be selected as required. After selecting, you need to click Replace below to replace it.
8.AllStructers can view the structure of the currently selected primer, such as hairpin structure, primer dimer and repeated base.
9. After selecting a primer, click on the primer sequence below, then right-click to pop up the option of copying information, and then export the designed primer. You can also export the results directly to a file.